Syllabus

Assigned problems are in orange.

Chapter 12 problems:

 13,15,19,20,21,23,24c,d,27,49b,53a,63,69,89,92,98

Answers:

#20      a. – same

            b. – same

            c. – structural isomers

            d. – unrelated

#24      c. 2,4-dimethylhexane

            d. 2,3-dimethylhexane

Chapter 13 problems:

 7a,b,e,11a,e, 19a,b,21b,c,31c,33c,35d,e,f,,67,69a,c,78,82

 

Chapter 14 problems:

1,7,11a-d,29b,c,d,37,43,51c,55,56,107,108,109

Answer to 56: The second is not a phenol because the OH must be attached to a benzene ring - a hexagon with a circle inside.

Answer to 108: c - it should be isopropyl alcohol

Extra questions: What are the organic products, if any, obtained from treating each alcohol in question 14.8 a,d and e with K2Cr2O7 and H2SO4?

Answers:

Chapter 15 problems:

5a-e,7,9,11a-c,f,15a-c,21a-d,27a,d,45b,d,e,51(Tollens has silver ions in it),55,87

 

Chapter 16 problems

1a,b,c,e,3a-c,7a,b,33a-c,39,43a,45a,49,49a-c,55a-d,

81b,d,106a,c

Stop for Test #1

Assigned problems are in purple

For test #2:

Chapter 16 problems:

49

Chapter 17 problems:

1,3,5,7a,b,c,e,f,29,37a,b,d,39a,c,d,43,46(structure only),59a,c,d,f,60a,f,61,94,101

# 46

 #60 a - true, f - true

Extra "Study Questions"

 

1.         What are alternate names for adrenaline and noradrenaline?

 

2.         What is the structural difference between the following: amphetamine, epinephrine and albuterol?  What two structural features do all have in common?

 

3.         Gives uses and/or occurrences of the following:

            a.)        barbiturates, like pentobarbital

            b.)        nicotine

            c.)        cocaine and novocain

            d.)        morphine, codeine and heroin

 

4.         Which in question 3. are amines and which are amides?

 

5.         Which in question 3 occur naturally in plants (alkaloids) and which are synthesized?

 

           

 Answers to amine study questions

 

  1.   another name for adrenaline is epinephrine; for noradrenaline is norepinephrine

 

  2.   Amphetamine is a mixture of two mirror-image isomers ;  epinephrine contains three additional -OH groups and one less -CH3 compared to amphetamine; albuterol contains 4 additional carbons compared to adrenaline; all contain a benzene ring and an amino group two carbons away

 

3,4,5

       a.) sedative and sleep-inducers, amides, synthetic

       b.)   drug found in tobacco; amine; natural alkaloid

       c.) cocaine is a pain-reliever, amine; natural alkaloid

           Novocain is a pain-reliever; amine; synthetic

       d.) morphine is a pain reliever (addictive); amine; natural alkaloid

            codeine is a pain reliever and antitussive (addictive); amine; most is synthesized from morphine

            heroin is a drug of abuse (“pain reliever”) (very addictive); amine; synthetic (made from morphine)

 

Chapter 18 problems:

9,17,19,33b,c,d,35a,b,c,37,39,43a,53,59,67a,b,71,87a,c,89,93,95,97,98a,b,109 (skip chitin),111,122,129,130

ANSWERS: 98a - reducing; 98b - nonreducing

More study questions for CARBOHYDRATES

 Study Questions:

 1. What is the requirement for a mirror-image isomer (enantiomer) and which of the following have these isomers?

 

 

 

 

 

 

 

 

 

 

2.         What is the difference between D- and L- glucose?

3.         What is “galactosemia”?  How is it treated?

4.         How do people with A, B, or O blood type differ with respect to carbohydrates?

5.         How is high-fructose corn syrup made?

6.         What is dietary “fiber”?

7.         Why is glycerol not a carbohydrate?

8.         What 3 forms does galactose have in solution?

9.         What is the difference between ribose and deoxyribose?

10.       Name 3 hexoses and 3 disaccharides.

 

Answers to Study Questions:

 

1.         4 different atoms or groups attached to a carbon. 

            A. and B. only

 

2.         They are mirror-image isomers (enantiomers):

            mirror images around all 4 chiral carbons.

 

3.         High galactose levels in the blood which will result in mental retardation.  Restrict galactose  (in milk products) in the diet.

 

4.         A - have a terminal µ-N-acetylgalactosamine

            B - have a terminal µ-galactose     AB both,  O neither

 

5.         Corn starch enz.® glucose enz.® glucose and fructose

 

6.         Mostly cellulose, if insoluble, and pectin, if soluble.

 

7.         No aldehyde nor ketone group

 

8.         µ, b, and “open-chain” or aldehyde

 

9.         Deoxyribose is missing an oxygen at C#2

 

10        Glucose, galactose, fructose.

            Maltose, lactose, sucrose

 

Study Outline for Test #2 - CHEM 110

 

Recognize amine and amide groups.

Know how to classify amines as primary, secondary or tertiary.

Be able to name amines using “common names” (like ethylmethyl amine)

Know about water solubility, especially of amines.

Be able to predict the structure of an amine after it reacts with an acid and the effect this has on its solubility and volatility (ease with which it vaporizes).

 

Recognize “chiral carbons”, enantiomers (mirror-image isomers) and their physical properties, especially the rotation of plane-polarized light, and chemical relationships.  Know what “D” and “L” refer to.

Know the rotation of plane-polarized light symbols: “d” or (+) for dextrorotatory and “l” or (-) for levorotatory. (Answer: D and L refer to the differences in the names of mirror-image isomers due to their 3-D structures while dextrorotatory and levorotatory refer to the ability of these isomers to rotate plane-polarized light to the right or to the left.)

 

Recognize the structure of a carbohydrate. (What is required for something to be a carbohydrate?)

Know and be able to use the following terms: aldose, ketose, tetrose, pentose, hexose. 

Recognize the “ring” structures of: glucose, galactose, ribose, 2-deoxyribose.

Know what the following mean: blood sugar, dextrose, fruit sugar, maltose, lactose, sucrose, (table, cane or beet     sugar), starch (amylose & amylopectin), glycogen, and cellulose.

Know what open chain, alpha- and beta- refer to.

Know what carbons are linked together when looking at a carbohydrate structure.

Know what (reducing sugar) reacts positively in the Benedict’s test or Tollens test and what the evidence for each test is.

Know about galactosemia and lactose intolerance.

Know the relative sweetness of lactose, glucose, sucrose, fructose, and aspartame. Know what “high-fructose corn syrup” is and how it is made.

Know what monosaccharides are responsible for blood types A (N-acetylgalactosamine), B (galactose), AB (both), and O (neither) and the importance of these.

Know how H. pylori interacts with cells in the stomach.

 

stop for test #2

DO problems in green

Chapter 19 problems

1,9,13,17,19a,b,c,23,27 (palmitic acid is 16:0),35a,b,d,37,39,43b,49,53,55,69,83,87,103,110,111,117b,c,118(skip b and e),124,129

Answer 110 - aspirin blocks the conversion of arachidonic acid to a prostaglandin, the molecule which causes inflammation

Answer 118 a - energy-storage, c - membrane, d - messenger, e - membrane, f - messenger

Study Questions on Lipids

 

  1.       What properties do all lipids share?

  2.       What are the features of common fatty acids?

  3.       To what physical property does the number of double bonds in a fatty acid relate?

  5.       How are fats and oils similar and how are they different?

  6.       What makes a substance a steroid?

  7.       What is the use of cholesterol and phosphatidyl choline in the body?

  8.       Where do trans fatty acids come from and what is there affect on health?

  9.       How are the components of the cell membrane arranged?

11.       What are the 4 classes of lipoproteins and what is the function of some of them in the body?       How are some of them related to atherosclerosis?

12.       What are hormones?  Give two major kinds of steroid hormones.

15.       Give an example of “partial hydrogenation of vegetable oil”.

16.  Predict the order of the melting points of triglycerides containing fatty acids, as follows:

            (a) palmitic, palmitic, stearic

            (b) oleic, stearic, palmitic

(c) oleic, linoleic, oleic

17.       What are omega-3 fatty acids and what is there relationship to health?

 

 

Answers to Lipid Questions

  1.       insoluble in water

  2.       even number of carbons, straight chains, cis-C=C sometimes

  3.       more C=C make it more fluid with a lower melting point

  5.       both are triglycerides but fats are solids and oils are liquids at room temperature

  6.       the 4 fused rings with 5 or 6 sides


 

 

 

7.   cholesterol moderates membrane fluidity and is the starting material for biosynthesis of other steroids while        phosphatidyl choline is used to make membranes and lipoproteins.

  8.   Trans fatty acids are made from natural cis fatty acids during the process of hydrogenation. Trans fatty acids seem to increase cholesterol levels and associated risk of heart disease.

  9.   a bilayer of lipid, primarily lecithin (PC), which can diffuse laterally; proteins float in the membrane and are found spanning the membrane or just attached to one surface; carbohydrate chains are found on the exterior surface only.

11.       HDL - return cholesterol to liver for processing - “protects” against atherosclerosis

            LDL - can bring cholesterol to arteries - increases risk of atherosclerosis

            VLDL - transport triglycerides from liver to fatty tissue

            chylomicrons - transport dietary triglycerides to liver

12.       chemical messengers in the body; adrenal (adrenocorticoid) hormones and the sex hormones

15.

       

16. lowest mp is (c); highest is (a)

17. Omega-3 have a C=C at the third carbon from the end of the fatty acid and they are good for lowering the risk of heart disease.

Chapter 20 problems:

3,15 (given structures),16 (given structures), 17,18,23d,37,38,41,47,63,64,66,69,72,75,76,78b,c,d,83,

90,91,101,102,111,113,116,117,119

Answers:

16 - a. nonpolar    b. polar neutral    c. polar neutral    d. polar basic (+ charged)

18 – glycine does not exist as enantiomers (no D or L forms)

38 – N-terminal is the end of the peptide chain near the –NH2 or ­ NH3+ end, while the C- terminal end is the end of the peptide chain near the –COOH or COO- end;

64 – they differ in sequence

66 – the N-H and the C=O as in N-H ... O=C

72 – see page 623

76a – fibrous have the same secondary (for example, wool has only alpha-helix) while globular (like insulin) have a mix of secondary and random shapes

76b – the body contains more fibrous (like collagen!)

78b – structural in skin, bones and teeth

78c – transport oxygen in blood

78d – store oxygen in tissues

90 – the first is a mix of amino acids and the second is a protein with a change 3-D shape

102 - density

 

Problems Chapter 21:

1,3,25,39,45,53,55,57,105

Study questions on Proteins:

 

1.  Looking at the side chains in Table 20.1, be able to classify them as nonpolar, polar neutral, acidic or basic.

2.  Which amino acid does not rotate plane-polarized light? Why?

3.  What functional group is present on serine?, aspartic acid?, lysine?

4.  Are amino acids in our body “L” or “D”?

5.  What is a zwitterion and what affect does it have?

6.  What are essential amino acids?

7.  Write the structural formula for a tripeptide with Ser at the C-terminus, Ala at the N-terminus and Cys in the middle? Indicate the C-terminus.

8.  What atoms constitute the peptide backbone?

9.  What is primary structure? What kind of bonding accounts for it?

10. What kind of amino acids might substitute for leucine and not change the character of the protein much?   

11. What is secondary structure? Give three main types, characteristics and fibrous examples.

 

Answers on Proteins:

1.  (see Table 20.1)

2.  glycine, no stereocenter

3.  an alcohol group, a carboxylic acid group, an amine group, 4.  “L”

5.  They contain both positive and negative charges causing higher m.p. and solubility in water.


6. The body can’t make them so you must eat them.
 

7.

 

 

8.  NCCNCCNCCNCC….

9.  The amino acid sequence in the protein. The peptide (amide bond).

10. Looking at structures in Table 12.1, the nonpolar amino acid (only C and H atoms except Met and Trp)

11. Regular repeating pattern due to h-bonding of peptide groupsŕ

alpha helix (often stretchable) (the alpha keratins of wool, hair, nails(-SS-), horns(-SS-)), beta sheet, (flexible) (small aa) (silk),

and triple helix (rigid, strong) (collagen, abundant)

Study Outline for Test #3 - CHEM 110

 

Lipids:

Know the composition and function of the following:

            Features of common fatty acids, [saturated, monounsaturated and polyunsaturated fatty acids] (affect of C=C and chain length on melting points), trans-fatty acids, structure of oleic acid & stearic acid,] soaps (including hard water effects on), detergents (including hard water effects on), waxes, triglycerides, fats, oils, phospholipids like phosphatidyl choline (lecithin), steroids, cholesterol.

Know how to use delta (Δ) and omega (ω) in naming and relation of omega-3 to health.

Know what hydrogenation refers to.

Know the reactants and products saponification of triglycerides.

Know about cell membranes, including:

            components and their orientation, movement within membranes.

Know about lipoproteins: their composition and function.

Know how soaps, detergents, and lecithin work similarly n their own environments.

Know the 4 classes of lipoproteins, their function and the relation of some of these to health

 

Proteins:

Know the following terms:

            Zwitterion (knowing which groups are charged), “complete protein” (vs. Jello®) & essential amino acids, D vs. L aa (& which are most common), peptide bond (recognize structure, also), the atoms in the protein (peptide) backbone

Know the 4 classes of amino acids and examples of each given in class (Gly, Ala, Ser, Asp, Lys). Recognize the chemical features of each class.

Know how aa are joined together and what the structure of typical peptides look like.

Name and define the four levels of protein structure.

Know the three kinds of secondary structure, alpha helix, beta sheet and triple helix, including differences and similarities, including H-bonding. Know the terms “native state” and “denaturation”. Give examples for denaturing proteins and indicate which forces are broken.

Know forces involved in protein structure and know which is the strongest

Give examples of globular proteins and examples of the three classes of fibrous proteins: alpha, beta, and triple helix.

 

Enzymes:

Know these terms:

            substrate, active site

Know effect of pH and temperature on enzyme activity

 

Know these terms:

            - induced fit

            - competitive inhibition, like sulfa drugs and role of PABA

            - zymogen

DONE with test #3

Assigned problems are in blue

Chapter 23 problems:

 5,19,23,35,49,51a,b,52,a,b,65,81

Answer 52 a - 3    b - 1  

Chapter 24 problems:

                  Glycolysis – 9,17,18,23,31a,38,43

Answer for 38: see p. 752 (top)

                  Glycogen – 51,61

                  Hormonal control – 71,81,82

                    Answer 82 - lowers blood glucose through processes      given in class

                  General – 96b,c

Chapter 25 problems:

        Fat catabolism – 25,37,43a-d,45,49

       105,106

 

Chapter 26 problems:

17,31,35c,41,58

Answer 58: carbon dioxide and ammonia

93,94

 

Study Questions on Metabolism

  1.       Energy released by burning glucose is present in what 2 forms?  List some uses of ATP’s energy. 

  2.       How is energy released from ATP?

  3.       What is the major way (type of phosphorylation) of making ATP?

  4.       Why is O2 required in the e-transport chain?  How many ATP’s are made from one FADH2?  from one NADH,H+ ?  from one FAD? 

  5.       What is the function of the Krebs cycle?  What compounds don’t get recycled in it?  (Be precise) 

        How many ATP’s can be made from the Krebs cycle using the e-transport chain?  Where in the cell does it occur?

  6.   How many ATP’s are made by glycolysis (ending in pyruvate) in muscle?  in the liver?  Why are they different?  How many ATP’s from one pyruvate to one acetyl CoA?  How many carbons are there in pyruvate?

  7.   How many ATP’s are made in anaerobic glycolysis?  What is its end product?  When will it occur as the predominant pathway?  What does this end product cause in the muscle?  Can it be reused? 

  8.   How may ATP’s are made from 1 glucose, aerobically?  anaerobically?

  9.   What is catabolism?  anabolism?  glycogenolysis?  Where does glycogenolysis occur completely?  How does insulin affect it?  What is glycogenesis?  How does insulin affect it in the liver?  What other thing does insulin affect?

 

SKIP --> 10.   What is gluconeogenesis?

 

SKIP -->11.    What are sources for gluconeogenesis?

 

12.   How are fats used for ATP production, including glycerol and fatty acids?  How many ATP’s can be

                                         O

                                         ||

       obtained from CH3(CH2)6COH    a)  from the fatty acid spiral alone (including priming)?       b)  from complete burning to CO2 ?        c)         Where do you lose ATP?

 

13.   What are the 3 ketone bodies?  (Recognize their names.)  Give 4 effects produced by elevated levels of ketone bodies.   What is acidosis?  How does the body attempt to deal with an onset of acidosis caused by ketone bodies?

 

Skip --> 14.   How are fatty acids made?  Where does it occur?

 

15.   What are the uses of amino acids in the body?  Are they stored in the body?

 

16.   Give 3 examples of proteins and the rates at which they break down.

 

17.   What reaction does the body use to make amino acids?  What are essential amino acids?  How do we get them?

 

18.   How are amino acids used for energy?  What product is always formed and why is this product toxic in high amounts?  What reaction cycle does the body use to detoxify it and what is the overall effect of this cycle?

 

                 Answers for Questions #1 - 18

 

  1.   Heat and ATP.  Muscle movement, nerve impulses, anabolism 

  2.   Hydrolysis to give ADP and, occasionally, AMP

   3.   Oxidative phosphorylation

 4.   To accept 2 H atoms,         1.5 ATP’s made                        2.5 ATP’s made                        No ATP’s made

  5.   Trap energy present in Acetyl CoA as ATP                        Acetyl only of Acetyl CoA and CO2

            10 ATPs made in mitochondria 

  6.   5 ATP in skeletal muscle, 7 in heart muscle and liver

            Requires an ATP to transport an NADH, H+ into the mitochondria

            2.5 ATP’s made                        3 carbons

   7.   2 ATP’s made,      Lactic Acid,      under low O2 conditions,                        soreness                       yes, if used soon.

   8.   30 or 32 ATP’s made                     2 ATP’s made

   9.   Breakdown of molecules to make ATP;                  assembling small molecules into large ones using up ATP;

            the breakdown of glycogen to glucose;                liver;                 decreases it;                  biosynthesis of glycogen form          glucose;                        increases it;                   glucose transport into muscle

 

10.  synthesis of “new” glucoses from non-carbohydrate materials

 

 11.    lactate and some amino acids

 

12.   glycerol of fats gives ATP’s through carbohydrate pathway (glycolysis) and fatty acids undergo fatty acid spiral (beta oxidation); 

            a)         10 ATP’s                       b)         50 ATP’s                      c)         the priming step

 

13.   acetoacetate, beta-hydroxybutyrate, acetone; acetone on breath, electrolyte imbalance, dehydration, and      rapid breathing; high concentration of ketone bodies in blood;       low blood pH;                rapid breathing

 

14.   fatty acid synthesis;            cytoplasm

 

15.   make proteins, supply nitrogen atoms for other compounds, for energy;          No

 

16.   collagen - 3 years, muscle - 3-6 months, serum proteins (antibodies) - 1-2 weeks

 

17.   transamination;       essential to the diet because the body can’t make them;   eat them

 

18.   remove the nitrogen atoms and break down the remaining structure to CO2 and water;

       ammonia is toxic                            urea cycle;        2NH3 + CO2  ®   urea + H2O

Study Guide for Test #4 - CHEM 110

 

Know the following terms and their uses:

 

metabolism,

catabolism,

anabolism,

ATP,

ADP,

AMP,

oxidative phosphorylation, including uncoupled systems, such as brown fat cells,

substrate level phosphorylation (e.g. in glycolysis)

Krebs, citric acid, or tricarboxylic acid cycle,

aerobic and anaerobic glycolysis,

pyruvate (including structure),

lactate (including structure),

Acetyl CoA,

NAD+ (and niacin),

FAD (and riboflavin),

Fatty acid oxidation (fatty acid spiral),

glycerol catabolism (enters glycolysis),

 

3 ketone bodies and their names,

indications of high levels of ketone bodies in the blood,

acidosis,

glycogenolysis in liver and muscle,

three effects of insulin,

diabetes,

transamination,

oxidative deamination,

urea cycle,

ketogenic amino acids,

glucogenic amino acids,

half-lives of various proteins in body,

essential amino acids,

PKU (including phenylalanine, tyrosine, and phenyl pyruvate)

 

 

Be able to determine the number of ATPs made through the processes of carbohydrate and fatty acid catabolism.

Know how and where carbons in catabolism are broken down and then converted into carbon dioxide.

Know which of the reactions of carbohydrate and fatty acid catabolism take place in the mitochondria and which take place in the cytoplasm.

Know how carbohydrates, fats and proteins are used proportionately during rest, short- and long-term exercise.

 

Do all of these questions for the TEST #5 on Nucleic Acids:

Chapter 22: 1,5,9,11b,c,d,15,25,29,35,37,

51b-d,53,57,63,71,77,85,129,130

Study questions on Nucleic Acids

 

  1.       What sugar is present in DNA?  In RNA?  Draw their structures. What are the various carbons of the sugar bonded to when in DNA or RNA?

  2.       Indicate the bases present in DNA.  In RNA? List nucleotides (abbreviations, like dGMP) in DNA. In RNA.

  3.       What components are found in the backbone of a nucleic acid?

  4.       What bases pair within DNA and between DNA and RNA? How are these base pairs held together?

  5.       What is a double helix?  What is replication?  What does the term “semiconservative” mean?

  6.       What is transcription and translation?

  7.       What is a codon and an anticodon and where are each found?

  8.       What are the three kinds of RNA and what is the function of each? 

 

  9.       A piece of DNA has the sequence 5’-GGTACAGATTGG-3’.  What RNA strand would be made from it? What complementary DNA strand would be made from it?

10.       Where in the cell is DNA found?  Where is RNA found?

11.       What are the start and stop codons?  What amino acid, if any does each code for?

12.       How does fluorouracil stop cancer?

13.       What are mutations?  What are some causes of mutations? What kind of mutation is most often lethal?

14.       How are cancer and mutations related?

15.       The following m-RNA will code for a peptide with how many amino acids?

            AAUGCCGGCUAUCGAAUAAGG

16.       What are introns and exons?

 

  

Answers for study questions on Nucleic Acids

 

  1.                   2-deoxyribose                                                  ribose

        carbon 1’ is bonded to the nitrogen base, 2’ to nothing, 3’ to phosphate, 4’ to O to make the 5-sided ring and 5’ to phosphate.

   2.   A,C,G,T.  A,C,G,U. dAMP, dTMP, dCMP and dGMP in DNA. AMP, UMP, CMP, and GMP in RNA.

   3.       Sugar and phosphates.

 4.   A to T by 2 H-bonds and G to C by 3 H-bonds within DNA.  Between DNA and RNA, T of DNA to A of RNA and A of DNA to U of RNA (both by 2 H-bonds) and G with C by 3 H-bonds. All base pairs have a three ring spacing.

   5.   2 anti-parallel strands of DNA held in a helical coil by H-bonds between N-bases facing inward.  Making of DNA copies in the nucleus.  Half parent, half new DNA in the daughter DNA.

   6.   The “transcribing” of sequence info in DNA to m-RNA in the cell nucleus.  The “translating” of sequence info into m-RNA to proteins at the ribosomes.

   7.       3-base sequence in m-RNA coding for a particular amino acid.  3-base sequence in t-RNA   complementary to the codon.

   8.       m-RNA, contains sequence information for directly coding the amino acid sequence of a protein;

            r-RNA is part of the ribosome which also contains protein;

        t-RNA (a cloverleaf-shaped RNA), carries an amino acid to the ribosome for protein synthesis, releases it, and goes and gets another.

   9.       3’-CCAUGUCUAACC-5’                   3’-CCATGTCTAACC-5’

 10.       In the nucleus.  In the nucleus and also as part of ribosomes outside of the cell nucleus.

11.       AUG codes for Met (methionine).  UAA codes for nothing.

12.       Prevents T from being made from U and therefore there is no T available for DNA synthesis.

 13.       Changes in replication which give non-identical copies.  Chemicals, nuclear and UV radiation, x-rays, spontaneous changes.  Base deletion and insertion.

 14.  Mutations may cause cancer, but not necessarily.

 15.  Five:  AUG codes for Met, followed by 4 more codons + then the stop codon UAA..

 16.  Introns are non-coding parts of DNA that separate exons (which are the coding parts). Introns may allow the cell to assemble different exons.

 

Study Guide for Test #5

Know about the following:

- DNA, RNA, including backbone, ribose and 2-deoxyribose (recognize their structures)

- nucleotides: know components including what bases (names and abbreviations) are used in making DNA or RNA

- double helix, antiparallel, base-pairs and hydrogen bonds, BASE PAIRING RULES (be able to use with examples)

- replication, semi-conservative, nucleus, fluorouracil

- transcription, m-RNA, (found in nucleus and at the ribosomes of the cytoplasm) BASE PAIRING RULES (be able to use with examples)

- translation, ribosome, r-RNA, m-RNA and codon (know: “start” is AUG (Met) and “stop” is UAA), t-RNA and anti-codon

- introns, exons,

- mutations: substitution (example in hemoglobin) & deletion; causes, mutagen, carcinogen